Abstract: Patients with the rare neurodevelopmental repair syndrome known as group A trichothiodystrophy (TTD-A) carry mutations in the gene encoding the p8 subunit of the transcription and DNA repair factor TFIIH. Here we describe the crystal structure of a minimal complex between Tfb5, the yeast ortholog of p8, and the C-terminal domain of Tfb2, the yeast p52 subunit of TFIIH. The structure revealed that these two polypeptides adopt the same fold, forming a compact pseudosymmetric heterodimer via a beta-strand addition and coiled coils interactions between terminal alpha-helices. Furthermore, Tfb5 protects a hydrophobic surface in Tfb2 from solvent, providing a rationale for the influence of p8 in the stabilization of p52 and explaining why mutations that weaken p8-p52 interactions lead to a reduced intracellular TFIIH concentration and a defect in nucleotide-excision repair, a common feature of TTD cells.

Abstract: The P4 protein of bacteriophage phi12 is a hexameric molecular motor closely related to superfamily 4 helicases. P4 converts chemical energy from ATP hydrolysis into mechanical work, to translocate single-stranded RNA into a viral capsid. The molecular basis of mechanochemical coupling, i.e. how small approximately 1 A changes in the ATP-binding site are amplified into nanometer scale motion along the nucleic acid, is not understood at the atomic level. Here we study in atomic detail the mechanochemical coupling using structural and biochemical analyses of P4 mutants. We show that a conserved region, consisting of superfamily 4 helicase motifs H3 and H4 and loop L2, constitutes the moving lever of the motor. The lever tip encompasses an RNA-binding site that moves along the mechanical reaction coordinate. The lever is flanked by gamma-phosphate sensors (Asn-234 and Ser-252) that report the nucleotide state of neighboring subunits and control the lever position. Insertion of an arginine finger (Arg-279) into the neighboring catalytic site is concomitant with lever movement and commences ATP hydrolysis. This ensures cooperative sequential hydrolysis that is tightly coupled to mechanical motion. Given the structural conservation, the mutated residues may play similar roles in other hexameric helicases and related molecular motors.

Abstract: A label- and immobilization-free approach to detecting the reversible formation of complexes between nucleic acids and proteins at the single-molecule level is described. The voltage-driven translocation of individual oligoribonucleotides through a nanoscale protein pore is observed by single-channel current recordings. The oligoribonucleotide 5'-C25A(25)-3' gives rise to current blockades with an average duration of approximately 0.5 ms. In the presence of the RNA-binding ATPase P4, a viral packaging motor from bacteriophage phi8, longer events of tens to hundreds of milliseconds are observed. Upon addition of ATP the long events disappear, indicating the dissociation of the P4RNA complex. The frequency of events also depends on the concentration of P4 and the length of the oligoribonucleotide, thereby confirming the specificity of the P4RNA events. This study shows that single-channel current recordings can be used to monitor RNA-protein complex formation, thus opening up a new means to examine the motor activity of RNA- or DNA-processing enzymes.

Abstract: Genome packaging into an empty capsid is an essential step in the assembly of many complex viruses. In double-stranded RNA (dsRNA) bacteriophages of the Cystoviridae family this step is performed by a hexameric helicase P4 which is one of the simplest packaging motors found in nature. Biochemical and structural studies of P4 proteins have led to a surprising finding that these proteins bear mechanistic and structural similarities to a variety of the pervasive RecA/F1-ATPase-like motors that are involved in diverse biological functions. This review describes the role of P4 proteins in assembly, transcription and replication of dsRNA bacteriophages as it has emerged over the past decade while focusing on the most recent structural studies. The P4 mechanism is compared with the models proposed for the related hexameric motors.

Abstract: Many viruses employ molecular motors to package their genomes into preformed empty capsids (procapsids). In dsRNA bacteriophages the packaging motor is a hexameric ATPase P4, which is an integral part of the multisubunit procapsid. Structural and biochemical studies revealed a plausible RNA-translocation mechanism for the isolated hexamer. However, little is known about the structure and regulation of the hexamer within the procapsid. Here we use hydrogen-deuterium exchange and mass spectrometry to delineate the interactions of the P4 hexamer with the bacteriophage phi12 procapsid. P4 associates with the procapsid via its C-terminal face. The interactions also stabilize subunit interfaces within the hexamer. The conformation of the virus-bound hexamer is more stable than the hexamer in solution, which is prone to spontaneous ring openings. We propose that the stabilization within the viral capsid increases the packaging processivity and confers selectivity during RNA loading.

Abstract: Molecular motors undergo cyclical conformational changes and convert chemical energy into mechanical work. The conformational dynamics of a viral packaging motor, the hexameric helicase P4 of dsRNA bacteriophage phi8, was visualized by hydrogen-deuterium exchange and high-resolution mass spectrometry. Concerted changes of exchange kinetics revealed a cooperative unit that dynamically links ATP-binding sites and the central RNA-binding channel. The cooperative unit is compatible with a structure-based model in which translocation is mediated by a swiveling helix. Deuterium labeling also revealed the transition state associated with RNA loading, which proceeds via opening of the hexameric ring. The loading mechanism is similar to that of other hexameric helicases. Hydrogen-deuterium exchange provides an important link between time-resolved spectroscopic observations and high-resolution structural snapshots of molecular machines.

Abstract: The hexameric ATPase P4 from bacteriophage phi 12 is responsible for packaging single-stranded genomic precursors into the viral procapsid. P4 was overexpressed in Escherichia coli and purified. Crystals of native and selenomethionine-derivatized P4 have been obtained that belong to space group I222, with half a hexamer in the asymmetric unit and unit-cell parameters a = 105.0, b = 130.5, c = 158.9 A. A second crystal form of different morphology can occur in the same crystallization drop. The second form belongs to space group P1, with four hexamers in the asymmetric unit and unit-cell parameters a = 114.9, b = 125.6, c = 153.9 A, alpha = 90.1, beta = 91.6, gamma = 90.4 degrees. Synchrotron X-ray diffraction data have been collected for the I222 and P1 crystal forms to 2.0 and 2.5 A resolution, respectively.

Abstract: Many complex viruses acquire their genome by active packaging into a viral precursor particle called a procapsid. Packaging is performed by a viral portal complex, which couples ATP hydrolysis to translocation of nucleic acid into the procapsid. The packaging process has been studied for a variety of viruses, but the mechanism of the associated ATPase remains elusive. In this study, the mechanism of RNA translocation in double-stranded RNA bacteriophages is characterized using rapid kinetic analyses. The portal complex of bacteriophage 8 is a hexamer of protein P4, which exhibits nucleotide triphosphatase activity. The kinetics of ATP binding reveals a two-step process: an initial, fast, second-order association, followed by a slower, first-order phase. The slower phase exhibits a high activation energy and has been assigned to a conformational change. ATP binding becomes cooperative in the presence of RNA. Steady-state kinetics of ATP hydrolysis, which proceeds only in the presence of RNA, also exhibits cooperativity. On the other hand, ADP release is fast and RNA-independent. The steady-state rate of hydrolysis increases with the length of the RNA substrate indicating processive translocation. Raman spectroscopy reveals that RNA binds to P4 via the phosphate backbone. The ATP-induced conformational change affects the backbone of the bound RNA but leaves the protein secondary structure unchanged. This is consistent with a model in which cooperativity is induced by an RNA link between subunits of the hexamers and translocation is effected by an axial movement of the subunits relative to one another upon ATP binding.

Abstract: Many viruses package their genome into preformed capsids using packaging motors powered by the hydrolysis of ATP. The hexameric ATPase P4 of dsRNA bacteriophage phi12, located at the vertices of the icosahedral capsid, is such a packaging motor. We have captured crystallographic structures of P4 for all the key points along the catalytic pathway, including apo, substrate analog bound, and product bound. Substrate and product binding have been observed as both binary complexes and ternary complexes with divalent cations. These structures reveal large movements of the putative RNA binding loop, which are coupled with nucleotide binding and hydrolysis, indicating how ATP hydrolysis drives RNA translocation through cooperative conformational changes. Two distinct conformations of bound nucleotide triphosphate suggest how hydrolysis is activated by RNA binding. This provides a model for chemomechanical coupling for a prototype of the large family of hexameric helicases and oligonucleotide translocating enzymes.

Abstract: Double-stranded RNA viruses sequester their genomes within a protein shell, called the polymerase complex. Translocation of ssRNA into (packaging) and out (transcription) of the polymerase complex are essential steps in the life cycle of the dsRNA bacteriophages of the Cystoviridae family (phi6-phi14). Both processes require a viral molecular motor P4, an NTPase, which bears structural and functional similarities to hexameric helicases. In effect, switching between the packaging and the transcription mode requires the translocation direction of the P4 motor to reverse. However, the mechanism of the reversal remains elusive. Here we characterize the P4 protein from bacteriophage phi12 and exploit its purine nucleotide specificity to delineate P4 role in transcription. The results indicate that while P4 actively translocates RNA during packaging it acts as a passive conduit for RNA export. The directionality switching is accomplished via the regulation of P4 NTPase activity within the polymerase core.

Abstract: Bacteriophage varphi12 protein P7 is a structural component of the polymerase complex and ensures stable packaging of the genomic RNA. varphi12 P7 has been cloned, purified and crystallized. Crystals belong to space group P3(2)21, with unit-cell parameters a = 75.7, b = 75.7, c = 45.2 A, alpha = 90, beta = 90, gamma = 120 degrees , and diffract beyond 2.0 A. Multiple anomalous dispersion data have been collected from crystals of selenomethionylated P7. Mass spectroscopy showed proteolysis of the crystallized protein and a truncated form, P7DeltaC, gave crystals of similar morphology. Cross-linking experiments implicated the N-terminal domain of P7 as being essential for dimerization.

Abstract: The C gene product of the modification-restriction system PvuII binds to its own promoter (C box) and stimulates transcription of both the C gene and the endonuclease gene. According to our data the same regulatory mechanism is realized in the EcoRV system. It was found that upstream of the EcoRV endonuclease gene two ATG codons give rise to two open reading frames (ORF1 and ORF2) ending at the same point inside the endonuclease gene. Two DNA fragments corresponding to ORF1 and ORF2 were cloned, and the homogenous products of proteins encoded by them were found to be DNA-binding proteins. A specific DNA sequence (C box) recognized by the proteins was determined with DNAse I footprinting. The C box CCCATTTTGGGTTATCCCATTTTGGG is located inside ORF1 and, similar to the PvuII C box consisting of tandem repeats of 11 nucleotides, is divided by four nucleotides. In its turn each of the repeats contains inverted repeats of four terminal nucleotides. The EcoRV C box sequence differs both from the PvuII C box sequence and from the proposed consensus sequence of C boxes in other modification-restriction systems.

Abstract: Double-stranded RNA (dsRNA) viruses are complex RNA processing machines that sequentially perform packaging, replication and transcription of their genomes. In order to characterize the assembly intermediates of such a machine we have developed an efficient in vitro assembly system for the procapsid of bacteriophage phi8. The major structural protein P1 is a stable and soluble tetramer. Three tetramers associate with a P2 monomer (RNA-dependent RNA polymerase) to form the nucleation complex. This complex is further stabilized by a P4 hexamer (packaging motor). Further assembly proceeds via rapid addition of individual building blocks. The incorporation of the packaging and replication machinery is under kinetic control. The in vitro assembled procapsids perform packaging, replication and transcription of viral RNA. Comparison with another dsRNA phage, phi6, indicates conservation of key assembly intermediates in the absence of sequence homology and suggests that a general assembly mechanism for the dsRNA virus lineage may exist.

Abstract: Genomes of complex viruses have been demonstrated, in many cases, to be packaged into preformed empty capsids (procapsids). This reaction is performed by molecular motors translocating nucleic acid against the concentration gradient at the expense of NTP hydrolysis. At present, the molecular mechanisms of packaging remain elusive due to the complex nature of packaging motors. In the case of the double-stranded RNA bacteriophage phi 6 from the Cystoviridae family, packaging of single-stranded genomic precursors requires a hexameric NTPase, P4. In the present study, the purified P4 proteins from two other cystoviruses, phi 8 and phi 13, were characterized and compared with phi 6 P4. All three proteins are hexameric, single-stranded RNA-stimulated NTPases with alpha/beta folds. Using a direct motor assay, we found that phi 8 and phi 13 P4 hexamers translocate 5' to 3' along ssRNA, whereas the analogous activity of phi 6 P4 requires association with the procapsid. This difference is explained by the intrinsically high affinity of phi 8 and phi 13 P4s for nucleic acids. The unidirectional translocation results in RNA helicase activity. Thus, P4 proteins of Cystoviridae exhibit extensive similarity to hexameric helicases and are simple models for studying viral packaging motor mechanisms.

Abstract: The packaging of genomic RNA in members of the Cystoviridae is performed by P4, a hexameric protein with NTPase activity. Across family members such as Phi6, Phi8 and Phi13, the P4 proteins show low levels of sequence identity, but presumably have similar atomic structures. Initial structure-determination efforts for P4 from Phi6 and Phi8 were hampered by difficulties in obtaining crystals that gave ordered diffraction. Diffraction from crystals of full-length P4 showed a variety of disorder and anisotropy. Subsequently, crystals of Phi13 P4 were obtained which yielded well ordered diffraction to 1.7 A. Comparison of the packing arrangements of P4 hexamers in different crystal forms and analysis of the disorder provides insights into the flexibility of this family of proteins, which might be an integral part of their biological function.